TP63 drives TKI resistance in EGFR-mutant lung cancer via ferroptosis inhibition

Introduction

Lung cancer remains the leading cause of cancer-related mortality worldwide, with non-small cell lung cancer (NSCLC) representing about 85% of all cases (1). Activating mutations in the epidermal growth factor receptor (EGFR) define a major molecular subset of NSCLC that initially responds to EGFR tyrosine kinase inhibitors (TKIs) such as gefitinib, erlotinib, and osimertinib (2). Despite dramatic initial responses, nearly all patients relapse due to acquired resistance (3,4). While secondary EGFR mutations such as T790M and C797S explain some cases, in many resistant tumors, the mechanism of resistance cannot be identified, representing a major clinical challenge (5,6). These adaptive processes are particularly evident in tumors treated with third-generation TKIs such as osimertinib, where resistance often arises independently of additional EGFR mutations (7). Therefore, understanding the alternative pathways that sustain resistant cell survival is crucial for designing effective combination therapies.

The transcription factor TP63, a member of the p53 gene family, is a master regulator of epithelial identity and homeostasis (8). Multiple TP63 isoforms exert distinct biological roles: ΔNp63, which lacks the N-terminal transactivation domain, acts as an oncogenic driver, while TAp63 generally functions as a tumor suppressor (9). Aberrant TP63 expression has been implicated in squamous cell carcinomas, where it maintains stemness, lineage fidelity, and resistance to stress-induced apoptosis (10). In lung squamous carcinoma, TP63 amplification occurs in up to 80% of cases, whereas in adenocarcinoma its expression is typically low but dynamically regulated during lineage plasticity and therapeutic adaptation (11,12). Accumulating evidence indicates that TP63 modulates DNA damage response, metabolic reprogramming, and cell fate transitions, but its potential role in orchestrating non-apoptotic death programs such as ferroptosis remains poorly defined (13-16).

Ferroptosis, an iron-dependent form of regulated cell death driven by lipid peroxidation, has recently emerged as a key vulnerability in cancer (17). Ferroptotic stress can be triggered by inhibition of the cystine/glutamate antiporter SLC7A11 or the lipid peroxide detoxifying enzyme GPX4, both of which act as central suppressors of ferroptosis (18,19). In EGFR-mutant NSCLC, accumulating evidence indicates that ferroptosis induction synergizes with EGFR-TKIs, whereas ferroptosis evasion contributes to acquired drug resistance (20). Osimertinib-resistant cells often exhibit upregulation of antioxidant and lipid metabolic pathways that buffer reactive oxygen species (ROS), allowing survival under therapeutic pressure (21). However, the transcriptional regulators that coordinate ferroptosis suppression during EGFR-TKI resistance remain largely unknown (22).

We identified that TP63 is consistently upregulated in osimertinib-resistant cell lines, and that silencing TP63 restores sensitivity to EGFR-TKIs. Mechanistically, TP63 suppresses ferroptotic programs, via transcriptional control of GPX4 and other antioxidant networks (23), establishing the TP63-ferroptosis axis as a mechanistic vulnerability and therapeutic target in EGFR-mutant lung cancer. Here, we combine functional, biochemical, and genomics approaches to identify TP63 as a novel regulator of driving TKI resistance in EGFR-mutant NSCLC. We present this article in accordance with the MDAR reporting checklist (available at https://cco.amegroups.com/article/view/10.21037/cco-2025-aw-151/rc).

Methods

Cell culture

The human EGFR-mutant lung adenocarcinoma cell lines, PC9 and HCC827, were acquired from the American Type Culture Collection (ATCC, Manassas, VA, USA). These cell lines were maintained in RPMI-1640 medium (Gibco, Waltham, MA, USA) supplemented with 10% fetal bovine serum (FBS; Gibco) and 1% penicillin-streptomycin (Gibco), and were incubated at 37 ℃ in a humidified atmosphere containing 5% CO₂. Cultures were passaged every 2–3 days by adding 0.25% Trypsin (Gibco) for 2–3 minutes at 37 ℃ and re-plating at a 1:4 ratio. All cell lines were routinely tested for mycoplasma contamination and authenticated by short tandem repeat (STR) profiling. The study was conducted in accordance with the Declaration of Helsinki and its subsequent amendments.

Short hairpin RNA (shRNA) constructs and lentivirus production

shRNAs were generated utilizing the online design platform provided by Horizon (Cambridge, UK). The sense and antisense strands constituting the shRNA duplex were synthesized by BGI Genomics (Qingdao, China) and subsequently incorporated into the FUW-H1P-Hygro-mCherry lentiviral vector, following established protocols (24). The sequencing data for the shRNA employed in this investigation is:

TP63-1: 5'-CCACTGAACTGAAGAAACT-3';
TP63-2: 5'-CGACAGTCTTGTACAATTT-3'.

Lentivirus was produced using 293FT cells by co-transfection with DR8.9 and VSVG packaging plasmids using polyethylenimine. The viral supernatants underwent ultracentrifugation at 50,000 g for a duration of 1.5 h. Subsequently, the resulting pellets were resuspended in PBS and preserved at −80 ℃, following the established methodology (25).

Lentiviral transduction

PC9-OR cells (3×10⁵) were transduced with lentivirus at a multiplicity of infection (MOI) of 5, with 8 µg/mL polybrene utilized as a transduction enhancer for 24 h. Following replacement of the medium with complete growth medium, the cells underwent selection utilizing 1 µg/mL puromycin for 48 h. Knockdown efficiency was confirmed by quantitative reverse transcription polymerase chain reaction (qRT-PCR) and immunoblotting.

RNA extraction and qRT-PCR

Total RNA was extracted using the FastPure total RNA isolation kit (Vazyme, Nanjing, China), followed by reverse transcription with HiScript II RT SuperMix (Vazyme). qPCR was performed using ChamQ Universal SYBR Master Mix (Vazyme) on a Bio-Rad CFX96 system (Hercules, CA, USA). All expression values were normalized against GAPDH. Standard curves were generated for each primer pair, and Ct values were calculated using an expression threshold of 100 RFU. The gene-specific primers (forward primer; reverse primer) used in the qPCR analysis were: Human total TP63 (GGCTGAGAACGGGAAGCTTGTCAT; CAGCCTTCTCCATGGTGGTGAAGA); Human ΔNp63 (GAAAACAATGCCCAGACTCAA; TGCGCGTGGTCTGTGTTA); Human TAp63 (TGTATCCGCATGCAGGACT; CTGTGTTATAGGGACTGGTGGAC); Human GAPDH (ACGAAGATCCCCAGATGATG; TGCTGTTGCCTGTACGTTTC).

Western blotting

Cellular extracts were generated employing RIPA lysis buffer (Beyotime, Shanghai, China) supplemented with protease and phosphatase inhibitors (Beyotime). Protein quantification was conducted using a BCA assay kit (Beyotime). Subsequently, 20 µg of protein extract was resolved via SDS-PAGE and transferred to PVDF membranes (Millipore, Burlington, MA, USA). Following blocking with 5% non-fat dry milk, membranes were incubated with primary antibodies overnight at 4 ℃. After washing, incubation with secondary antibodies was performed for 1 hour at room temperature. Post-washing, blots were developed using a Super ECL Substrate Detection Kit (Elabscience, Wuhan, China) and quantified on the OI600 system (Guangyi, Guangzhou, China). The primary antibodies utilized in this Western blotting procedure were anti-TP63 (Proteintech, Rosemont, IL, USA; 1:2,000) and anti-GAPDH (Biosharp, Beijing, China; 1:5,000). Densitometric analysis was performed utilizing ImageJ software (version 1.46).

Cell viability assay

Cell viability assay was assessed using the Cell Counting Kit-8 (Yeasen, Shanghai, China). PC9-OR cells (5,000 per well) were plated in 96-well plates and treated with or without osimertinib for 72 h. CCK-8 reagent (1:10 dilution) was added, and absorbance at 450 nm was measured after 2 h using a spectrophotometer (Molecular Devices, San Jose, CA, USA). Half-maximal inhibitory concentration (IC₅₀) values were calculated from dose-response curves using GraphPad Prism 9.0 software.

Wound-healing assay

Cells were seeded into 6-well plates and cultivated until 90% confluency was achieved. A standardized scratch was introduced using a sterile pipette tip. Non-adherent cells were removed via PBS wash. Subsequently, cells were subjected to treatment with or without osimertinib, followed by imaging at 24 and 48 h using light microscopy and quantitative analysis performed with ImageJ software.

Cell invasion assay

A total of 5×10⁴ cells, suspended in 200 µL of serum-free medium, were introduced into matrigel-coated Transwell inserts (6.5 mm diameter, 8.0 µm pore size). The lower chamber was supplemented with 500 µL of complete medium containing 20% FBS and osimertinib. Following incubation at 37 ℃ for 36 h, cells remaining on the apical side of the membrane were meticulously removed. The invasive cells on the basolateral side were fixed with 4% paraformaldehyde (PFA, Biosharp) for 30 minutes, stained with crystal violet, and quantified under light microscopy (Nikon, Tokyo, Japan) by enumerating cells in five randomly selected fields of view.

Colony formation assay

A total of 2,000 cells per well were seeded in a 6-well plate and incubated for 24 hours. Following osimertinib treatment, incubation continued for 21 days. Subsequently, colonies were fixed with 4% PFA for 25 minutes, stained with crystal violet (Biosharp) for 20 minutes, and finally imaged using an optical microscope (Nikon).

Cell cycle assay

Cells were fixed in 70% ethanol at 4 ℃ overnight, stained with DAPI (10 µg/mL) in 0.1% Triton X-100 for 30 min at room temperature, and analyzed using a flow cytometer (405 nm excitation, 450/50 nm emission). Cell-cycle profiles were determined using FlowJo software.

RNA sequencing analysis

RNA integrity was confirmed with an Agilent 2100 Bioanalyzer (Santa Clara, CA, USA). Libraries were prepared with the VAHTS Universal V8 RNA-Seq Kit (Yeasen) and sequenced on an MGI-SEQ 2000 platform (Shenzhen, China). Differentially expressed genes were identified using DESeq2 (adjusted P<0.05). Gene set enrichment and pathway analyses were performed using Gene Set Enrichment Analysis (GSEA) and Kyoto Encyclopedia of Genes and Genomes (KEGG) (26).

Immunofluorescence

Cells underwent fixation utilizing a 4% PFA, followed by a blocking step employing 5% BSA. Subsequently, the cells were incubated with primary antibodies targeting GPX4 (Zenbio, Durham, NC, USA; 1:1,000), and then incubated with secondary antibodies. Finally, nuclear counterstaining was performed with DAPI, and imaging was conducted via immunofluorescence microscopy (27) (Zeiss, Oberkochen, Germany).

3D tumor spheroid culture

A total of 2×10³ cells in 20 µL of serum-free DMEM were mixed with an equal volume of Matrigel (Yeasen) on ice, and dispensed as dome-shaped droplets onto the pre-cooled wells. Cells were incubated at 37 ℃ with 5% CO₂ for 30 min, and fed with pre-warmed complete medium. Spheroid formation and morphology were monitored daily, and imaged using a light microscope (Nikon).

Lipid peroxidation assay

The intensely fluorescent BODIPY is an effective tracer of lipid trafficking (28). The cells were incubated with 1 µM C11-BODIPY 581/591 (S1111S, Beyotime) in complete medium at 37 ℃ in the dark for 30 minutes. Following a single wash with PBS, imaging was performed using a Carl Zeiss immunofluorescence microscope. The oxidized (green) to reduced (red) fluorescence ratio was quantified as a relative measure of lipid peroxidation.

Statistical analysis

All experiments were independently repeated at least three times. Data are presented as mean ± SD. Statistical significance was determined by two-tailed Student’s t-test or one-way ANOVA with Tukey’s post hoc correction (P<0.05). GraphPad Prism 9.0 was used for analysis.

Results

TP63 is highly induced in osimertinib-resistant EGFR-mutant NSCLC cells

To determine whether TP63 participates in the development of acquired resistance to the third-generation EGFR-TKI osimertinib, we established resistant derivatives of the EGFR-mutant NSCLC cell lines PC9 and HCC827 through a gradual dose-escalation protocol. Cells were continuously exposed to increasing concentrations of osimertinib (25–100 nM) over 14 days, until stable proliferative populations were obtained that maintained continuous growth in the presence of osimertinib, thereby establishing long-term, stable resistance rather than transient drug-tolerant persister (DTP) states. Once the half-maximal inhibitory concentration (IC₅₀) exceeded that of the parental counterparts by over 100-fold, the resulting cell populations were designated PC9-OR and HCC827-OR (Figure 1A).

Figure 1 TP63 is highly upregulated in osimertinib-resistant EGFR-mutant NSCLC cells. (A) Schematic illustration of the generation of osimertinib-resistant derivatives (PC9-OR and HCC827-OR) from parental PC9 and HCC827 cells. (B,C) Morphology of parental and resistant PC9 (B) and HCC827 (C) cells with or without osimertinib (100 nM). (D,E) CCK-8 assay of survival rates in parental and resistant PC9 (D) and HCC827 (E) cells with or without osimertinib (750 nM). (F,G) Quantitative RT-PCR analysis of TP63 mRNA levels in PC9 and PC9-OR cells (F) and HCC827 and HCC827-OR cells (G) normalized to GAPDH. (H,I) Immunoblot analysis (H) and quantification analysis (I) of TP63 and GAPDH protein levels in PC9 and PC9-OR cells. (J,K) Immunoblot analysis (J) and quantification analysis (K) of TP63 and GAPDH protein levels in HCC827 and HCC827-OR cells. Data represent mean ± SD of three independent experiments by two-tailed Student’s t-test. Scale bar, 100 µm. **P<0.01; ***P<0.001; ****P<0.0001; ns, not significant. EGFR, epidermal growth factor receptor; NSCLC, non-small cell lung cancer; RT-PCR, reverse transcription polymerase chain reaction; Osi., osimertinib; SD, standard deviation; Unt., untreated.

Morphologically, compared to parental PC9 and HCC827 cells, PC9-OR and HCC827-OR cells displayed normal morphology and sustained proliferation, with no evidence of cell death under osimertinib exposure (Figure 1B,1C). Cell viability assays further demonstrated that the proliferation of PC9-OR and HCC827-OR cells was unaffected by 100 nM osimertinib, whereas the same treatment caused marked viability inhibition in the parental lines (Figure 1D,1E). These results confirmed that the resistant lines faithfully model the clinical phenotype of acquired osimertinib resistance.

To explore whether TP63 expression is associated with the resistant state, we performed qRT-PCR and immunoblotting. TP63 mRNA levels increased by approximately 11-fold in PC9-OR and 1.8-fold in HCC827-OR relative to parental cells (Figure 1F,1G). Consistent with this, TP63 protein abundance increased approximately fivefold in PC9-OR and threefold in HCC827-OR (Figure 1H-1K). These findings suggest that TP63 upregulation is a consistent feature of osimertinib-resistant EGFR-mutant NSCLC cells.

TP63 knockdown does not affect cell viability of osimertinib-resistant EGFR-mutant NSCLC cells

To delineate TP63 isoform dynamics associated with acquired osimertinib resistance, we quantified the expression of ΔNp63 and TAp63 transcripts in parental PC9 and PC9-OR cells. Quantitative PCR analysis revealed that ΔNp63 represents the predominant TP63 transcript in PC9 cells, whereas TAp63 expression was comparatively low. Notably, ΔNp63 expression was further elevated by approximately 8-fold in PC9-OR cells relative to parental PC9 cells, accounting for the overall increase in total TP63 levels observed under chronic osimertinib exposure, while TAp63 expression remained largely unchanged (Figure 2A).

Figure 2 Generation and characterization of TP63 knockdown in osimertinib-resistant NSCLC cells. (A) Quantitative RT-PCR analysis of ΔNp63 and TAP63 in parental PC9 and PC9-OR cells. (B,C) Quantitative RT-PCR analysis (B) and Western blotting analysis (C) of PC9-OR cells transduced with shTP63-1 and shTP63-2. (D,E) Morphology (D) and CCK-8 assay (E) of PC9-OR, and PC9-OR cells transduced with shTP63-1 and shTP63-2. (F) Transcriptome analysis of PC9-OR, and PC9-OR cells transduced with shTP63-1 and shTP63-2. (G,H) KEGG (G) and GO (H) pathway enrichment analyses of differentially expressed genes. Data represent mean ± SD of three biological replicates. Scale bar, 200 µm. **P<0.01; ***P<0.001; ns, not significant. BP, biological process; CC, cellular component; GO, Gene Ontology; KEGG, Kyoto Encyclopedia of Genes and Genomes; MF, molecular function; NSCLC, non-small cell lung cancer; RT-PCR, reverse transcription polymerase chain reaction; SD, standard deviation.

To test whether TP63 is required for basal cell growth, we silenced TP63 in PC9-OR cells using two independent shRNAs (shTP63-1 and shTP63-2). Both constructs efficiently reduced TP63 transcript levels by approximately 90% and 80%, and protein levels by 70% and 60%, respectively (Figure 2B,2C). Despite the efficient knockdown, there was no apparent change in cell morphology, confluency, or proliferation (Figure 2D,2E). These results indicate that TP63 is dispensable for the survival of osimertinib-resistant cells in the absence of drug stress.

To assess the global transcriptional consequences of TP63 loss, we performed RNA sequencing of control and TP63-depleted PC9-OR cells. Differential expression analysis identified 357 significantly altered genes (adjusted P<0.05), including 108 downregulated and 249 upregulated transcripts (Figure 2F). KEGG pathway enrichment revealed significant changes in pathways related to ECM-receptor interaction, cytokine-cytokine receptor signaling, PI3K-Akt, MAPK, and central carbon metabolism in cancer (Figure 2G,2H). The altered expression of several metabolic and signaling regulators suggests that TP63 depletion may remodel stress-adaptive transcriptional programs toward a less proliferative and metabolically rigid state.

TP63 depletion restores osimertinib sensitivity in osimertinib-resistant EGFR-mutant NSCLC cells

To determine whether TP63 contributes to the resistant phenotype, we compared the effects of osimertinib on proliferation and clonogenic potential between control and TP63-silenced PC9-OR cells. Cell viability assays demonstrated that TP63 knockdown markedly enhanced osimertinib sensitivity. Upon 72 hours of exposure to 750 nM osimertinib, cell viability was reduced by approximately 80% compared with control PC9-OR cells (Figure 3A,3B).

Figure 3 TP63 depletion restores osimertinib sensitivity and suppresses malignant phenotypes of resistant cells. (A,B) Morphology (A) and CCK-8 assay (B) of PC9-OR and shTP63 PC9-OR cells after 72 h of osimertinib treatment (750 nM). (C,D) Representative images of crystal violet-stained colonies (C) and quantification (D) of colony formation assays of PC9-OR and shTP63 PC9-OR cells after 21 d of osimertinib treatment (750 nM). (E,F) Representative images (E) and quantification (F) of wound-healing assay in PC9-OR and shTP63 PC9-OR cells after 24 and 48 h of osimertinib treatment (100 nM); quantification at 48 h. (G,H) Representative images of crystal violet-stained invaded cells (G) and quantification (H) of transwell invasion assay in PC9-OR and shTP63 PC9-OR cells after 48 h of osimertinib treatment (750 nM). (I,J) Flow cytometric analysis (I) and quantification (J) of cell-cycle distribution in PC9-OR and shTP63 PC9-OR cells after 48 h of osimertinib treatment (750 nM). (K,L) Morphology (K) and CCK-8 assay (L) of 3D spheroid cultures derived from control and TP63-knockdown of PC9-OR or HCC827-OR cells after 48 h of osimertinib treatment (750 nM). Data are shown as mean ± SD from three independent experiments. Scale bar, 100 µm. **P<0.01; ***P<0.001; ns, not significant. Osi., osimertinib; SD, standard deviation; Unt., untreated.

Colony formation assays further revealed that TP63 silencing alone had a modest effect on colony formation, but when combined with osimertinib treatment, colony formation was nearly abolished. The number of colonies was reduced by approximately 85% in both shTP63-1 and shTP63-2 lines compared with controls (Figure 3C,3D).

To assess the impact on tumor cell motility, we performed wound-healing and transwell invasion assays. TP63-depleted cells displayed significantly impaired migration and invasion under osimertinib treatment (Figure 3E-3H). These inhibitory effects were largely dependent on drug presence, indicating that TP63 confers survival and motility advantages specifically under drug stress.

Flow cytometric analysis of cell-cycle distribution revealed that TP63 knockdown in combination with osimertinib caused a pronounced G₀/G₁-phase arrest, accompanied by a reduction in S- and G₂/M-phase populations by 21.68% and 21.23%, respectively (Figure 3I,3J).

To more closely recapitulate in vivo tumor architecture, microenvironmental interactions, and cellular heterogeneity, we extended our analysis to three-dimensional (3D) spheroid cultures. In the absence of osimertinib, TP63-depleted PC9-OR and HCC827 cells formed spheroids at frequencies comparable to controls. In contrast, upon osimertinib treatment, TP63 depletion significantly impaired spheroid maintenance, resulting in a ~30% reduction in spheroid number in PC9-OR cells and a ~20% reduction in HCC827 cells relative to controls (Figure 3K,3L). These findings underscore a context-dependent requirement for TP63 in sustaining tumor growth within a more physiologically relevant 3D setting under EGFR-TKI challenge.

Collectively, these findings indicate that TP63 depletion restores osimertinib sensitivity by limiting cell-cycle progression and attenuating tumorigenic behaviors, including proliferation, migration, and invasion.

TP63 loss alters transcriptional responses to osimertinib stress

To delineate the mechanisms by which TP63 mediates resistance, we next performed RNA-seq on PC9-OR cells treated with osimertinib (750 nM, 48 h) with or without TP63 knockdown. A total of 166 genes were differentially expressed (adjusted P<0.05), including 61 downregulated and 105 upregulated transcripts (Figure 4A). Pathway enrichment analysis revealed that TP63 loss under drug pressure preferentially affected genes involved in ferroptosis, MAPK signaling, and amino acid metabolism (Figure 4B,4C). These changes were largely specific to osimertinib-treated conditions, consistent with a role for TP63 in maintaining stress-adaptive transcriptional states rather than supporting basal gene expression.

Figure 4 Transcriptomic profiling reveals TP63-dependent responses to osimertinib stress. (A) Differential gene expression analysis of control and TP63-knockdown PC9-OR cells after 48 h of osimertinib treatment (750 nM). (B,C) KEGG (B) and GO (C) enrichment analyses of PC9-OR control and shTP63 cells after 48 h of osimertinib treatment (750 nM). BP, biological process; CC, cellular component; GO, Gene Ontology; KEGG, Kyoto Encyclopedia of Genes and Genomes; MF, molecular function; OSI, osimertinib.

TP63 depletion sensitizes cells to ferroptosis under osimertinib treatment

Among ferroptosis-associated genes, GPX4, a glutathione peroxidase that detoxifies lipid hydroperoxides, was notably downregulated upon TP63 silencing. Immunofluorescence staining confirmed a marked reduction in GPX4 protein in TP63-depleted PC9-OR cells compared with PC9-OR cells (Figure 5A), consistent with the transcriptional changes observed. Further, we assessed lipid peroxidation using the oxidation-sensitive probe BODIPY 581/591 C11. In control cells, fluorescence was predominantly red, indicating a reduced lipid state, whereas TP63-depleted cells treated with osimertinib displayed a pronounced increase in green fluorescence, reflecting lipid oxidation (Figure 5B). Similar results were observed in 3D tumor spheroids, where TP63 knockdown in combination with osimertinib induced a clear shift from reduced to oxidized lipid states (Figure 5C), supporting enhanced oxidative stress under more physiologically relevant conditions.

Figure 5 TP63 loss restores osimertinib sensitivity through induction of ferroptosis. (A) Immunofluorescence staining of GPX4 in control and TP63-knockdown PC9-OR and HCC827-OR cells after 48 h of osimertinib treatment (750 nM). Cells were fixed with 4% PFA, incubated with anti-GPX4 primary antibody (1:1,000), followed by fluorescent secondary antibody, and counterstained with DAPI to visualize nuclei. (B) Lipid peroxidation assessed by BODIPY 581/591 C11 staining in control and TP63-knockdown PC9-OR and HCC827-OR cells after 48 h of osimertinib treatment (750 nM). The ratio of oxidized (green) to reduced (red) fluorescence indicates the level of lipid peroxidation. (C) BODIPY 581/591 C11 staining of 3D spheroid cultures derived from control and TP63-knockdown PC9-OR and HCC827-OR cells after 48 h of osimertinib treatment (750 nM). Increased green fluorescence indicates enhanced lipid peroxidation. (D) CCK-8 viability assay showing partial rescue by the ferroptosis inhibitor ferrostatin-1 (1 µM, 12 h pretreatment) in TP63-knockdown PC9-OR and HCC827-OR cells after 48 h of osimertinib treatment (750 nM). Data are shown as mean ± SD from three independent experiments. **P<0.01; ***P<0.001. Scale bar, 100 µm. OSI, osimertinib; SD, standard deviation.

To determine whether ferroptosis contributes functionally to the restored drug sensitivity, we performed rescue experiments using the ferroptosis inhibitor ferrostatin-1. Osimertinib treatment substantially reduced the viability of TP63-silenced PC9-OR and HCC827-OR cells, whereas co-treatment with ferrostatin-1 significantly restored cell viability (Figure 5D). These results indicate that TP63 depletion sensitizes resistant cells to osimertinib, at least in part, by promoting ferroptotic cell death.

Clinical relevance of TP63 upregulation in EGFR-mutant NSCLC

To provide context for the potential clinical relevance of TP63, we analyzed RNA-seq data from The Cancer Genome Atlas (TCGA) lung adenocarcinoma cohort using GEPIA2 (http://gepia2.cancer-pku.cn). Kaplan-Meier survival analysis showed that high TP63 expression correlated with significantly shorter overall survival (P=0.03), whereas disease-free survival did not differ significantly (P=0.84) between high- and low-expression groups (Figure 6A,6B), providing contextual evidence that TP63 is clinically relevant in EGFR-mutant lung adenocarcinoma at the population level.

Figure 6 Clinical relevance of TP63 expression in lung adenocarcinoma patients. (A) Kaplan-Meier analysis of overall survival in EGFR-mutant lung adenocarcinoma patients stratified by high versus low TP63 expression using TCGA-LUAD cohort (GEPIA2). High TP63 expression correlates with significantly shorter overall survival (P=0.03, log-rank test). (B) Kaplan-Meier analysis of disease-free survival showing no significant difference between high and low TP63 expression groups (P=0.84, log-rank test). All analyses were performed using publicly available RNA-seq and clinical datasets; shaded areas indicate 95% confidence intervals.

Discussion

The development of acquired resistance to EGFR-TKIs poses a substantial impediment to the effective treatment of EGFR-mutant NSCLC (2,29). In this study, we report that the transcription factor TP63 functions as a lineage-restricted safeguard of survival in EGFR-mutant NSCLC subjected to third-generation EGFR inhibition.

We found that TP63 induction is a consistent feature of acquired osimertinib resistance. Resistant derivatives maintained proliferation under clinically relevant osimertinib concentrations while upregulating TP63 at both mRNA and protein levels; the PC9 model showed the largest fold induction, motivating its use in mechanistic follow-up. This observation complements prior reports that therapy-stressed epithelial tumors often activate lineage-defining transcriptional programs as adaptive responses (30). Unlike canonical genetic resistance mechanisms (secondary EGFR mutations or bypass RTK activation) (31), the TP63 increase we observe reflects a transcriptional/lineage adaptation that is reversible and targetable. Thus, TP63 provides a non-mutational axis that can be exploited therapeutically and explains, in part, why many clinical relapses lack a clear resistance mutation (32).

Our viability analysis showed that TP63 supports drug tolerance without sustaining basal viability. TP63 knockdown alone produced minimal effects on proliferation or morphology in the absence of osimertinib, yet strongly augmented the cytotoxicity of osimertinib across multiple assays—viability, clonogenicity, migration/invasion and cell cycle progression. This context-dependent requirement indicates that TP63 is not a core housekeeping factor for transformed cells (33) but rather a stress-responsive transcriptional regulator whose function becomes essential when EGFR signaling is pharmacologically suppressed. From a translational standpoint, such “conditional essentiality” is attractive: therapies that target stress-induced dependencies can spare normal tissues while selectively resensitizing drug-exposed tumor cells.

The integrated transcriptomic and functional analyses reveal that TP63 preserves redox homeostasis and suppresses ferroptosis in the face of TKI stress. TP63 depletion under osimertinib markedly downregulated GPX4 and altered expression of multiple metabolic and redox-related pathways, and immunofluorescence confirmed loss of GPX4 protein in TP63-silenced cells. Functionally, TP63 loss in the presence of osimertinib induced hallmarks consistent with ferroptotic vulnerability (including reduction in GPX4, increased lipid peroxidation, and rescue of cell viability by ferroptosis inhibitors). Together these data indicate that TP63 transcriptionally sustains an antioxidant program that neutralizes lipid peroxides and prevents ferroptotic collapse during EGFR blockade. Conceptually, this places TP63 upstream of a cell fate decision—whether drug-stressed cells survive by engaging protective transcriptional programs (TP63-high) or succumb through oxidative lipid damage (TP63-low).

Our findings dovetail with emerging evidence that ferroptosis is a therapeutically exploitable vulnerability in targeted-therapy-resistant cancers (34). Where resistance arises via metabolic or antioxidant rewiring, pharmacologic induction of ferroptosis or inhibition of GPX4/SLC7A11 can selectively kill tolerant persister cells and restore drug efficacy (35). Our data provide a concrete molecular entry point—TP63—linking lineage programing to ferroptosis control. Importantly, TP63 manipulation does not merely phenocopy direct GPX4 inhibition (36); it rewires a broader transcriptional network (ECM interactions, PI3K-Akt, MAPK and amino-acid metabolism) that likely shapes the cellular context in which ferroptosis sensitivity is determined. Consequently, TP63-directed strategies might achieve deeper and more durable responses by collapsing multiple adaptive axes simultaneously.

We provide initial clinical correlation supporting the translational relevance of TP63. Analysis of TCGA lung adenocarcinoma cohorts indicates that high TP63 expression associates with worsened overall survival, consistent with a model in which TP63 upregulation enables treatment escape and disease progression (37).

A key limitation of our study is that the TCGA-LUAD dataset primarily comprises treatment-naïve tumors, which may not fully recapitulate transcriptional programs underlying acquired resistance to EGFR-TKIs. Consequently, while our analysis demonstrates that high TP63 expression correlates with poorer overall survival in EGFR-mutant lung adenocarcinoma, it should be interpreted as contextual clinical relevance rather than direct evidence of TKI resistance. Future studies incorporating longitudinal patient samples will be critical to confirm the clinical applicability of the TP63-ferroptosis axis in acquired TKI resistance (38).

Conclusions

In summary, we demonstrate that TP63 upregulation is a key adaptive mechanism in osimertinib-resistant EGFR-mutant NSCLC. TP63 functions to preserve redox balance and prevent ferroptosis by maintaining GPX4 expression under therapeutic stress. Targeting the TP63-ferroptosis axis offers a promising therapeutic avenue to resensitize resistant tumors to EGFR-TKIs.

Acknowledgments

None.

Footnote

Reporting Checklist: The authors have completed the MDAR reporting checklist. Available at https://cco.amegroups.com/article/view/10.21037/cco-2025-aw-151/rc

Data Sharing Statement: Available at https://cco.amegroups.com/article/view/10.21037/cco-2025-aw-151/dss

Peer Review File: Available at https://cco.amegroups.com/article/view/10.21037/cco-2025-aw-151/prf

Funding: The study was funded by the National Natural Science Foundation of China (No. 32200653) and the “Medicine Plus” Interdisciplinary Cluster Joint Exploration Project of Qingdao Medical University (No.RZ2400001468).

Conflicts of Interest: All authors have completed the ICMJE uniform disclosure form (available at https://cco.amegroups.com/article/view/10.21037/cco-2025-aw-151/coif). The authors have no conflicts of interest to declare.

Ethical Statement: The authors are accountable for all aspects of the work in ensuring that questions related to the accuracy or integrity of any part of the work are appropriately investigated and resolved. The study was conducted in accordance with the Declaration of Helsinki and its subsequent amendments. This study involved established human cancer cell lines and publicly available datasets. No human participants or animal experiments were conducted; therefore, ethical approval and informed consent were not required.

Open Access Statement: This is an Open Access article distributed in accordance with the Creative Commons Attribution-NonCommercial-NoDerivs 4.0 International License (CC BY-NC-ND 4.0), which permits the non-commercial replication and distribution of the article with the strict proviso that no changes or edits are made and the original work is properly cited (including links to both the formal publication through the relevant DOI and the license). See: https://creativecommons.org/licenses/by-nc-nd/4.0/.

References

1. Hendriks LEL, Remon J, Faivre-Finn C, et al. Non-small-cell lung cancer. Nat Rev Dis Primers 2024;10:71. [Crossref] [PubMed]
2. de Miguel FJ, Gentile C, Feng WW, et al. Mammalian SWI/SNF chromatin remodeling complexes promote tyrosine kinase inhibitor resistance in EGFR-mutant lung cancer. Cancer Cell 2023;41:1516-1534.e9. [Crossref] [PubMed]
3. Leonetti A, Sharma S, Minari R, et al. Resistance mechanisms to osimertinib in EGFR-mutated non-small cell lung cancer. Br J Cancer 2019;121:725-37. [Crossref] [PubMed]
4. Fu K, Xie F, Wang F, et al. Therapeutic strategies for EGFR-mutated non-small cell lung cancer patients with osimertinib resistance. J Hematol Oncol 2022;15:173. [Crossref] [PubMed]
5. Thress KS, Paweletz CP, Felip E, et al. Acquired EGFR C797S mutation mediates resistance to AZD9291 in non-small cell lung cancer harboring EGFR T790M. Nat Med 2015;21:560-2. [Crossref] [PubMed]
6. Kashima K, Kawauchi H, Tanimura H, et al. CH7233163 Overcomes Osimertinib-Resistant EGFR-Del19/T790M/C797S Mutation. Mol Cancer Ther 2020;19:2288-97. [Crossref] [PubMed]
7. Singh S, Sadhukhan S, Sonawane A. 20 years since the approval of first EGFR-TKI, gefitinib: Insight and foresight. Biochim Biophys Acta Rev Cancer 2023;1878:188967. [Crossref] [PubMed]
8. Aberdam E, Roux LN, Secrétan PH, et al. Improvement of epidermal covering on AEC patients with severe skin erosions by PRIMA-1(MET)/APR-246. Cell Death Dis 2020;11:30. [Crossref] [PubMed]
9. Wang Y, Freedman JA, Liu H, et al. Associations between RNA splicing regulatory variants of stemness-related genes and racial disparities in susceptibility to prostate cancer. Int J Cancer 2017;141:731-43. [Crossref] [PubMed]
10. Ning B, Tilston-Lunel AM, Simonetti J, et al. Convergence of YAP/TAZ, TEAD and TP63 activity is associated with bronchial premalignant severity and progression. J Exp Clin Cancer Res 2023;42:116. [Crossref] [PubMed]
11. Zhang A, Miao K, Sun H, et al. Tumor heterogeneity reshapes the tumor microenvironment to influence drug resistance. Int J Biol Sci 2022;18:3019-33. [Crossref] [PubMed]
12. Chua KP, Teng YHF, Tan AC, et al. Integrative Profiling of T790M-Negative EGFR-Mutated NSCLC Reveals Pervasive Lineage Transition and Therapeutic Opportunities. Clin Cancer Res 2021;27:5939-50. [Crossref] [PubMed]
13. McDade SS, Patel D, Moran M, et al. Genome-wide characterization reveals complex interplay between TP53 and TP63 in response to genotoxic stress. Nucleic Acids Res 2014;42:6270-85. [Crossref] [PubMed]
14. Bretz AC, Gittler MP, Charles JP, et al. ΔNp63 activates the Fanconi anemia DNA repair pathway and limits the efficacy of cisplatin treatment in squamous cell carcinoma. Nucleic Acids Res 2016;44:3204-18. [Crossref] [PubMed]
15. Su X, Gi YJ, Chakravarti D, et al. TAp63 is a master transcriptional regulator of lipid and glucose metabolism. Cell Metab 2012;16:511-25. [Crossref] [PubMed]
16. Katoh I, Fukunishi N, Fujimuro M, et al. Repression of Wnt/β-catenin response elements by p63 (TP63). Cell Cycle 2016;15:699-710. [Crossref] [PubMed]
17. Liu H, Xue H, Guo Q, et al. Ferroptosis meets inflammation: A new frontier in cancer therapy. Cancer Lett 2025;620:217696. [Crossref] [PubMed]
18. Lin ZH, Liu Y, Xue NJ, et al. Quercetin Protects against MPP(+)/MPTP-Induced Dopaminergic Neuron Death in Parkinson's Disease by Inhibiting Ferroptosis. Oxid Med Cell Longev 2022;2022:7769355. [Crossref] [PubMed]
19. Zhang Y, Shi J, Liu X, et al. BAP1 links metabolic regulation of ferroptosis to tumour suppression. Nat Cell Biol 2018;20:1181-92. [Crossref] [PubMed]
20. Lv S, Pan Q, Lu W, et al. Author Correction: Tenovin 3 induces apoptosis and ferroptosis in EGFR 19del non small cell lung cancer cells. Sci Rep 2024;14:17087. [Crossref] [PubMed]
21. Oren Y, Tsabar M, Cuoco MS, et al. Cycling cancer persister cells arise from lineages with distinct programs. Nature 2021;596:576-82. [Crossref] [PubMed]
22. Wu J, Zheng C, Wang Y, et al. Correction: LncRNA APCDD1L-AS1 induces icotinib resistance by inhibition of EGFR autophagic degradation via the miR-1322/miR-1972/ miR-324-3p-SIRT5 axis in lung adenocarcinoma. Biomark Res 2023;11:51. [Crossref] [PubMed]
23. Cai H, Yang J, Luo F, et al. TP63 as a modulator of ferroptosis in TP53 mutations glioblastoma. Cell Death Dis 2025;16:614. [Crossref] [PubMed]
24. Wang Z, Gearhart MD, Lee YW, et al. A Non-canonical BCOR-PRC1.1 Complex Represses Differentiation Programs in Human ESCs. Cell Stem Cell 2018;22:235-251.e9. [Crossref] [PubMed]
25. Wang Z, Oron E, Nelson B, et al. Distinct lineage specification roles for NANOG, OCT4, and SOX2 in human embryonic stem cells. Cell Stem Cell 2012;10:440-54. [Crossref] [PubMed]
26. Qiao Z, Zhang G, Chen X, et al. Aspirin-Inspired 6-O-Carboxymethyl-N-Acetylglucosamine: A potent antitumor agent with enhanced efficacy. Apoptosis 2025;30:2254-68. [Crossref] [PubMed]
27. Chen X, Zhang G, Qiao Z, et al. Glucosamine alleviates liver fibrosis through modulation of sinusoidal blood flow and hepatic immune responses. Biomed Pharmacother 2025;188:118180. [Crossref] [PubMed]
28. Bai J, Pagano RE. Measurement of spontaneous transfer and transbilayer movement of BODIPY-labeled lipids in lipid vesicles. Biochemistry 1997;36:8840-8. [Crossref] [PubMed]
29. Lv F, Sun L, Yang Q, et al. Prognostic Value of BIM Deletion in EGFR-Mutant NSCLC Patients Treated with EGFR-TKIs: A Meta-Analysis. Biomed Res Int 2021;2021:3621828. [Crossref] [PubMed]
30. Quintanal-Villalonga Á, Chan JM, Yu HA, et al. Lineage plasticity in cancer: a shared pathway of therapeutic resistance. Nat Rev Clin Oncol 2020;17:360-71. [Crossref] [PubMed]
31. Yu L, Bazhenova L, Gold K, et al. Clinicopathologic and molecular characteristics of EGFR-mutant lung adenocarcinomas that transform to small cell lung cancer after TKI therapy. Transl Lung Cancer Res 2022;11:452-61. [Crossref] [PubMed]
32. Yang X, Li X, Yan J, et al. Response to EGFR/NTRK/MET Co-Inhibition Guided by Paired NGS in Advanced NSCLC With Acquired EGFR L858R/T790M/C797S Mutations. J Natl Compr Canc Netw 2024;23:e247070. [PubMed]
33. Chen Z, Cai H, Ye W, et al. TP63 transcriptionally regulates SLC7A5 to suppress ferroptosis in head and neck squamous cell carcinoma. Front Immunol 2024;15:1445472. [Crossref] [PubMed]
34. Zhang T, Sun B, Zhong C, et al. Targeting histone deacetylase enhances the therapeutic effect of Erastin-induced ferroptosis in EGFR-activating mutant lung adenocarcinoma. Transl Lung Cancer Res 2021;10:1857-72. [Crossref] [PubMed]
35. Wang J, Liao L, Miao B, et al. Deciphering the role of the MALT1-RC3H1 axis in regulating GPX4 protein stability. Proc Natl Acad Sci U S A 2025;122:e2419625121. [Crossref] [PubMed]
36. Shi WK, Liu YX, Qiu XY, et al. Construction and validation of a novel Ferroptosis-related gene signature predictive model in rectal Cancer. BMC Genomics 2022;23:764. [Crossref] [PubMed]
37. Zu L, He J, Zhou N, et al. Identification of multiple organ metastasis-associated hub mRNA/miRNA signatures in non-small cell lung cancer. Cell Death Dis 2023;14:798. [Crossref] [PubMed]
38. Napoli M, Wu SJ, Gore BL, et al. ΔNp63 regulates a common landscape of enhancer associated genes in non-small cell lung cancer. Nat Commun 2022;13:614. [Crossref] [PubMed]